Skip to content
Open to opportunities

Hi, I'm

IQRA RIAZ

Web Developer, React Developer, Bioinformatics Graduate, Problem Solver

Bioinformatics graduate turned web developer. I combine a research-grade analytical mindset with modern front-end craft to build clean, responsive and interactive web experiences.

View My Work Download CV
Islamabad, Pakistan

// who i am

About Me

I'm a Bioinformatics graduate transitioning into web development, currently building practical skills in HTML5, CSS3, JavaScript (ES6+) and React.

My research-intensive MS thesis, involving Python, Linux/Unix and large-scale genomic data analysis, gave me a strong programming and analytical foundation.

I'm comfortable with independent learning, structured problem-solving and working in Linux-based environments, and I'm now expanding this foundation into full-stack web development.

Location
Islamabad, Pakistan
Email
iqrariaz5003@gmail.com
Phone
+92 302 9388957
LinkedIn
iqra-riaz
Languages
English & Urdu

MS Bioinformatics

NUST, 2026

Web Dev Intern

Mar – Jun 2026

Python • R • JS

Core languages

Islamabad, PK

Based in

“Research taught me to think in systems. Web development lets me build them.”
— Iqra Riaz

// where i've worked

Work Experience

  1. March 2026 – June 2026

    Web Development Intern

    PNY Trainings

    Arfa Kareem Software Technology Park, Lahore

    • Built responsive, interactive UIs using HTML5, CSS3 and JavaScript with cross-browser compatibility
    • Developed reusable components with React fundamentals, styled using Tailwind CSS
    • Worked on backend integration with Node.js, contributing to full-stack feature development
    HTML5CSS3JavaScriptReactTailwind CSSNode.js
  2. Previous Role

    Digital Administrator

    Reckon Chemicals Pvt Ltd

    • Managed and organized digital records and documents
    • Supported day-to-day online operations and communication
    • Helped maintain orderly digital workflows

// what i work with

Skills & Toolkit

Frontend

  • HTML5Strong
  • CSS3Strong
  • JavaScript (ES6+)Comfortable
  • React (fundamentals)Developing
  • Tailwind CSSComfortable

Backend

  • Node.js (basics)Basics

Programming & Scripting

  • PythonComfortable
  • RComfortable
  • Bash (basic)Basics

Environments & Workflow

  • Linux/Unix command lineComfortable
  • Version-controlled workflows (Git)Developing

Data & Analysis

  • Data cleaningStrong
  • Statistical analysisComfortable
  • Data visualizationComfortable
  • Structured problem-solvingStrong

Currently Learning

learning
  • Backend fundamentals
  • REST APIs
  • Database-driven applications

Growing from front-end into full-stack, one concept at a time.

◆React◆JavaScript◆Tailwind◆Node.js◆Python◆R◆Linux◆Git◆HTML5◆CSS3

// things i've built

Featured Work

ATGCGTACCGATTACGGCTAGCATGCCGTAATGCGTACCGATTACGGCTAGCATGCCGTAATGCGTACCGATTACGGCTAGCATGCCGTAATGCGTACCGATTACGGCTAGCATGCCGTAATGCGTACCGATTACGGCTAGCATGCCGTAATGCGTACCGATTACGGCTAGCATGCCGTA

MS Thesis · NUST

Comparative Genomic Insights into Akkermansia muciniphila spp. for Unveiling Potential Therapeutic Targets

A research project built on multi-step computational pipelines and large-scale genomic data analysis.

PythonRLinuxBashGenomicsData Analysis
Coming Soon

Web Project — Coming Soon

A new front-end project is on the way. Check back soon.

HTML5CSS3JavaScript
In Progress

Full-Stack App — In Progress

A full-stack application currently being built.

ReactNode.jsREST APIs

// where i studied

Education

2026

Master of Bioinformatics

NUST, Islamabad

2026
2023

Bachelor of Bioinformatics

COMSATS University Islamabad, Sahiwal Campus

2023

// why work with me

What I bring to your team

Analytical Mindset

Research-trained, data-driven problem solving.

Fast Independent Learner

Picked up new tools and workflows on my own.

Clean, Responsive UI

Modern interfaces that work on every device.

// get in touch

Let's Build Something Great Together

Open to web development roles, internships and collaborations. Let's talk.

Location

Islamabad, Pakistan